Recombinant DNA key - North Central College

1 Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site for a restriction enzyme? A. TGCCGT B. TGCGCA C. TGCTGC D. All of the above. E. None of the above. 2. Which of the following is not needed for DNA sequencing by the method we discussed in class? A. Radioactive primer B. DNA polymerase C. Fluorescent dideoxy nucleotides D. Ordinary nucleotides (dNTPs) E. All of the above are required. 3. What is the key enzyme used in PCR? A. ATP synthase B. Taq DNA polymerase C. DNA ligase D. Restriction enzymes E. Sigma factor Short answer (show your work or thinking to get partial credit): 1. Recombinant human insulin, produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes.

2 The human insulin gene encodes an mRNA only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns. a. If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true. This gene has introns; bacteria don't. If we cloned the gene directly, the bacteria would produce mRNA that includes the introns and be unable to splice it. Therefore, no functional protein could be made. b. What technique should be used instead in order to get a functional insulin coding sequence cloned into bacteria? Describe briefly how this technique works. We should use cDNA cloning. In this technique, we isolate mRNA from the cytoplasm of a cell, so that it has already been spliced. We then use reverse transcriptase enzyme to make a DNA copy (cDNA) of the mRNA.

3 This DNA can then be cloned, producing a bacteria7readable gene that lacks introns. c. Every cell in the human body has the same DNA, so every cell has an insulin gene. However, in order to use the technique you described in "b," you would have to start with cells from the pancreas77the only body cells that actually produce the insulin protein. Why are these the only cells that would work? We need insulin mRNA in order to do cDNA cloning. If the cells are the only ones that make insulin protein, then most likely they are also the only ones that make significant amounts of insulin mRNA. 2. Human gene therapy remains a promising possibility but is still plagued by problems. In the table below are listed two possible vectors and two problems. For each combination, please briefly explain if the specific problem is expected to be encountered for the vector.

4 Retroviral Vector liposome Immune Response Could be a problem; someone who s had a retroviral infection before could be immune to the vector, or if multiple treatments are necessary, development of immunity could be a big drawback. Should not be a problem. Proteins, not lipids, usually trigger the immune response. Insertional Mutagenesis Could be a problem, because the retrovirus inserts DNA randomly into the cell s genome; it could hit a gene by chance. Liposomes usually deliver plasmids or other DNA that won t integrate into the genome. Shouldn t be a problem. 3. The diagram below represents a section of the human genome. The coding sequence of a gene, YFG, is shown by an arrow, and boxes indicate the locations of some regulatory sequences. Locations of recognition sequences (cut sites) for three common restriction enzymes (EcoRI, BamHI, and NcoI) are also marked.

5 You would like to clone this gene in E. coli for further study. You have available the expression vector (plasmid) shown below: a. Why is it important for this plasmid to be an expression vector? Eukaryotic genes have regulatory signals like enhancers and TATA boxes that are not recognized by bacteria and lack the 710 and 735 sequences that bacterial RNA polymerase needs to start transcription. In addition, eukaryotic ribosomes find the correct AUG codon by scanning from the cap to the first AUG, while bacteria rely on a Shine7 Dalgarno sequence in the mRNA. These bacterial regulatory signals are provided by the expression vector. If we use a plasmid that did not have these signals, it's very unlikely that the bacteria would be able to transcribe and translate our gene. b. Why is it important for this plasmid to have an antibiotic7resistance gene?

6 This gives a way to select for bacteria that acquire the plasmid. The frequency of successful transformation is small, so we need a way to know that we got the clone into a cell. Only cells that acquire this plasmid will be able to grow in the presence of this antibiotic. c. What restriction enzyme would you use to clone this gene? Explain your choice. The plasmid has sites for all three restriction enzymes. However, EcoRI cuts the plasmid twice, so we would wind up chopping out a piece of the plasmid, including the needed Shine7 Dalgarno region. This is a bad choice. BamHI is also a bad choice, because it cuts in the middle of the gene we want to clone. We want an enzyme that will leave our gene intact. NotI is the best choice. It will cut our gene out of the genome and makes a single cut for inserting it into the plasmid.

7 Notice that it's not important that the enhancer and TATA sequences will be left behind; the plasmid provides the needed regulatory signals. 4. You would like to use PCR to amplify (make many copies of) the boxed section of the DNA sequence below: 5 ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGG CA 3 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCC GT 5 You ask your lab partner to order a pair of primers that can be used in the PCR reaction. The sequences of the primers he orders are: Primer #1: 5 ATAGAC 3 Primer #2: 5 ACTTAC 3 a. Oops! Looks like you shouldn t have trusted your lab partner on this one. Which of the two primers is wrong, and why won t it work? Primer #1 is OK: it will bind to the bottom strand, and its 3 end will then be pointed in the right direction for Taq DNA polymerase to synthesize the desired DNA.

8 Primer #2 won t work, because it binds to other end of the same strand and so its 3 end is pointed out away from the sequence to be copied: 5 ATAGAC-> 5 ACTTAC-> 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCC GT 5 b. Give the sequence of a primer that will work and could be used instead of the wrong one. Be sure to indicate the 5 and 3 ends. We need a primer that will bind to the top strand, with its 3 end pointed toward the left so that the other strand can be copied. For example, 5 GTAAGT 3 : 5 ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGG CA 3 <-TGAATG 5 5 ATAGAC-> 3 TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCC GT 5 5. You are trying to find the gene responsible for a human genetic disorder. You have mapped the gene to a particular chromosome region, and examining the human genome sequence for that region gives you the nucleotide sequence below: 5 CATACTTACTACTAGATTACGATTAGACGATTAGGATG|G CC|GAC|TCG|TGC|AGT|AAC| AGC|ATG|ACC|GAG|GCC|TAGACCAGATTAGGAGCCGG ACCAGGACGGACCAGCGACT 3 a.

9 Assuming you are reading the non7coding strand and that there are no introns, find an open reading frame (ORF) in this region. Circle the point where translation will start, and put a box around the point where translation will stop. Then give the number of amino acids in the protein this gene would encode: 12 amino acids (start codon encodes an amino acid; stop codon doesn t) b. If you wanted to express this gene in E. coli, what would need to be present in your cloning vector to ensure that it will be transcribed and translated? The gene s promoter sequence won t be recognized by E. coli s sigma factor, so you ll need a prokaryotic promoter ( 10 and 35 sequences). E. coli ribosomes can only find the correct start codon by first binding the Shine7 Dalgarno sequence, so the vector should also have this sequence positioned just before the desired start codon.

10 C. How might the protein produced by E. coli differ from the protein produced from the same gene in a human cell? The amino7acid sequence (primary structure) will be the same. However, eukaryotic proteins are often modified in the ER or Golgi: carbohydrates added, phosphate groups added, etc. These modifications probably won t happen in E. coli. Also, it s possible that the protein won t be correctly folded, if some specific protein or condition in the eukaryotic cell is needed for folding. 6. You have cloned a cDNA encoding a human hormone, and you hope to produce the hormone in bacteria in order to treat a severe genetic disorder. Unfortunately, when you insert this DNA into a plasmid and transform it into the bacteria, you get no hormone production. Give two valid reasons for your failure, and suggest a possible solution in each case.