Example: biology

Correlation Between Wastewater Treatment …

(Bucharest) 69 No. 1 201810 Correlation Between Wastewater Treatment Performancesand sludge CharacteristicsCOSTEL BUMBAC, ELENA ELISABETA MANEA*, OLGA TIRON, VALERIU ROBERT BADESCUN ational Research and Development Institute for Industrial Ecology - ECOIND, 71-73 Drumul Podul Dambovitei Str., 060652,Bucharest, RomaniaThe balance Between biotechnological useful microorganisms species, as well as the aerobic sludge granulesmorphology influences the Treatment plant performance . This paper presents an attempt to correlate theexperimental results on Wastewater Treatment performance with aerobic granular sludge structuralcommunity. The experiments were conducted in two lab scale bioreactors operated in parallel at differentretention times. Treatment performances achieved in both systems lead to an effluent that complies NTPA001limits, both systems being able of simultaneous nitrification / denitrification and phosphorus removal.

10 http://www.revistadechimie.ro REV.CHIM.(Bucharest)♦69♦No. 1 ♦2018 Correlation Between Wastewater Treatment Performances and Sludge Characteristics COSTEL BUMBAC, ELENA ELISABETA MANEA*, …

Tags:

  Performance, Sludge, Wastewater, Treatment, Between, Correlations, Characteristics, Correlation between wastewater treatment, Correlation between wastewater treatment performances and sludge characteristics

Information

Domain:

Source:

Link to this page:

Please notify us if you found a problem with this document:

Other abuse

Advertisement

Transcription of Correlation Between Wastewater Treatment …

1 (Bucharest) 69 No. 1 201810 Correlation Between Wastewater Treatment Performancesand sludge CharacteristicsCOSTEL BUMBAC, ELENA ELISABETA MANEA*, OLGA TIRON, VALERIU ROBERT BADESCUN ational Research and Development Institute for Industrial Ecology - ECOIND, 71-73 Drumul Podul Dambovitei Str., 060652,Bucharest, RomaniaThe balance Between biotechnological useful microorganisms species, as well as the aerobic sludge granulesmorphology influences the Treatment plant performance . This paper presents an attempt to correlate theexperimental results on Wastewater Treatment performance with aerobic granular sludge structuralcommunity. The experiments were conducted in two lab scale bioreactors operated in parallel at differentretention times. Treatment performances achieved in both systems lead to an effluent that complies NTPA001limits, both systems being able of simultaneous nitrification / denitrification and phosphorus removal.

2 Forqualitative and quantitative analysis of aerobic granular sludge specific microorganisms, DNA has beensucceesfully isolated and purifyied from sludge samples, thus obtaining bacterial DNA extracts inconcentrations of up to 56 ng/mL and 78% purity. The resulted DNA extracts were used for qPCR was carried out in the presence of a series of 10 pairs of primers for the detection / quantificationof specific bacteria and genes involved in the Treatment process: universal bacteria; Micotrix parvicella;Ammonia oxidizing archaea; Ammonium monooxigenase; Nitrobacter Sp.; nitrite reductase; N2O reductase;phosphorus accumulating microorganisms. The experimental results showed a qualitative and quantitativeimprovement of the sludge quality in terms of species distribution and share of biotechnologically : aerobic granular sludge , Wastewater Treatment , polymerase chain reaction (PCR), DNAIn each Wastewater Treatment plant biological stage,during time, the microbial composition is becoming stableand specific for the influents particular pollutant matrix[1] and subsequently a direct link is established betweenthe microbial composition of activated sludge (AS) andthe efficiency of Wastewater Treatment plants (WWTPs).

3 The long term development and maintenance of stableinterconnected trophic relationships betweenmicroorganisms is by far the main target of WWTP operators in order to ensure stable performances and toavoid nonstable growth, pin floc problems, deficientnitrification/denitrification as well as filamentous bulkingor foaming with a major impact on the effluent quality [2,3]. In most cases the operational control of WWTPs isconducted based on sensors (for DO, ammonia or nitrateconcentration) and on physical-chemical analyses ofinfluent/effluent/ sludge quality parameters. However, anychange of the operational parameters or influentcharacteristic (pollutant shock loads) induces firstlymodifications in the microbial populations composition ofAS, influencing the metabolic pathways [4, 5] thus favoringthe suppression/growth/overgrowth of species,sometimes with long term effects on wastewatertreatment performances, if proper response actions and foaming are wide-spread problems, beingreported by many Wastewater Treatment plants around theworld, causing: sludge loss (translated in low treatmentperformance and reduced effluent quality), recirculationdifficulties, depletion of oxygen transfer thus inhibitingnitrification, and difficulty in maintaining the appropriatesludge concentration in the aeration basin [2].

4 Microscopic quantification of AS quality is currentlybased on evaluating its macroscopic and microscopiccharacteristics [6] and communities characterization, inparticular, protists and filamentous bacteria as bioindicators[7-9].The biochemical and genetically basis of microbialdegradation is linked to several enzymes allowingmicroorganism to biodegrade various bacteria are chemolithotrophic organisms thatinclude species of the genera Nitrosomonas,Nitrosococcus, Nitrobacter and Nitrococcus. Thesebacteria get their energy by oxidizing inorganic nitrogencompounds [10]. Types include ammonia-oxidizingbacteria (AOB) and nitrite-oxidizing bacteria (NOB). Manyspecies of nitrifying bacteria have complex internalmembrane systems that are the location for key enzymesin nitrification: ammonia monooxygenase (which oxidizesammonia to hydroxylamine), hydroxylamine oxido-reductase (which oxidizes hydroxylamine to nitric oxide -which forms nitrite in the presence of oxygen), and nitriteoxidoreductase (which oxidizes nitrite to nitrate).

5 Bothammonia-oxidizing archaea (AOA) and ammonia-oxidizing bacteria (AOB) have the enzyme bacteria are able of performing denitrificationas part of the nitrogen cycle. They metabolise nitrate usinga complex set of enzymes (nitrate reductase, nitritereductase, nitrite oxide reductase and nitrous oxidereductase) turning step by step nitrogen oxides back tonitrogen are currently being made to identify, improve andintensify Treatment performances as effluent qualityrequirements are increasing [10-12]. The identification andquantification of specific genes could be linked to keymicrobial species and biological processes involved inwastewater Treatment such as nitrification, denitrification,and phosphorus removal thus offering a good image oftreatment performances [7] and/or of required operationalparameters adjustments.

6 * email: Phone: 0040214100377/ (Bucharest) 69 No. 1 2018 partMaterials and methodsTwo identical column type sequential biological reactors(D and GSBRs) with a height to diameter ratio of 10 and atotal working volume of 6 L were used to evaluate thehydraulic retention time (HRT) impact on the treatmentperformances and on aerobic granular sludge microbialdiversity. Each of the SBR reactors consisted of: influentvessel (40 L), feeding pump (Heidolph, PUMPDRIVE 5001,and peristaltic pump), column type bioreactor, effluentvessel (60 L). The cyclic operation of the SBR systemswas ensured by computer-based SBR control systemwhich controlled the feeding pumps and air inlet andeffluent outlet electrovalves. Total HRT of the bioreactorswas 6 and 8 hours respectively, with the followingoperational time sequence: anaerobic feeding (10 min.)

7 ,aerobic reaction (D=5h 35min; G=7h 35 min.), settling(5min.) and effluent withdrawal (10 min.). During aerobicreaction stage, an air compressor supplied each columnat an airflow of 8 bioreactors were fed with dairy industrywastewater characterized by high organic and nutrientsload: 968 2390 mg O2/L CODCr; 492 1806 mg O2/LBOD5; 36 67 mg/L NH4+; 46 72 mg/L total N; 5 17 mg/L total determinationsTreatment performances were evaluated based on COD,NH4+, NO2-, NO3- and PO43-. COD was analysedvolumetrically based on potassium dichromate methodaccording to the ISO standard (SR ISO 6060:1996) andusing heating mantle (Model KI16, Gerhardt, Germany).NH4+, NO2- , NO3- and PO43- were determined according tothe SR EN ISO 14911:2003 and SR EN ISO 10304/1:2009standards (for the last two indicators), respectively, usingion chromatography system ICS-3000 (Dionex, USA).

8 DNA extraction and amplification protocolThe deoxyribonucleic acids (DNA) of microorganismsin granules was extracted using PowerSoil DNA IsolationKit and protocol (MO BIO Laboratoris). The methodinvolves steps of mechanical and chemical cell lysatefollowed by successive steps of precipitation of organicand inorganic substances (non DNA), fixing DNA on aselective membrane and elution thereof in a buffer this method, bacterial DNA extracts from aerobicgranular sludge (10 mg) were made at concentrations upto 56 ng / L and 78% purity. DNA extracts obtained fromsludge samples of both bioreactors at different timeintervals were subjected to specific PCR amplification inthe presence of PowerSYBR Green PCR Master Mix (10 L),reverse and forward primer (100nM each), template (100ng) and nuclease free water (up to 20 L).For all sludge samples, a series of primer pairs identifiedin literature [13-19] were used: Micotrix parvicella M1 f(GGTGTGGGGAGAACTCAACTC) and M2 r (GACCCCGAAGGACACCG); Ammonia oxidizing archaea arch-amoAF (STAATGGTCTGGCTTAGACG) and Arch-amoAR(GCGGCCATCCATCTGTATGT); Ammonium mono-oxigenaseAMO A-1f (GGGGTTTCTACT GGTGGT) and AmoA-2r CCCCTCKGSAAAGCCTCCTCC; Nitrobacter (TTTT TTGAGATTTGCTAG) and FGPS 1269'(CTAAAACTCAAAGGAATTGA); Nitrite Reductase NIRkNIRk1f (GGMATGGTKCCSTGGCA) and NIRk 5R(GCCTCGATCAGRTTRTGGTT); N2O reductase (NOSz) -NOSz-f (CGYTGTTCMTCGACAGCCAG) andNOSz 1622 r(CGSACC TTSTTGCCSTYGCG); Phosphate accumulatingmicroorganisms pao462f (GTTAATACCCTGW GTAGATGACGG) and pao651r (CCCTCTGCCAAACTCCAG) and pao846R (GTTAGCTACG GCACTAAAAGG).

9 PAO I-179L(ACAGATCAACAAGTTCTACATCTTCGAC) and I-179R(GGTGTTGTCGTTCCAGTAGAGGATGTC); Universal Bacteria341F (CCTACGGGAGG CAGCAG) and 515R (AATCCGCGGCTGGCA).Amplification protocol: initial template denaturation (10min, 950C) followed by 40 cycles of amplification (denatureat 950C for 15 sfollowed by 60 sof annealing/extending at600C).Results and discussionsThe Treatment performances achieved in bothbioreactors, in terms of COD removal exceeded at all times90%. The quality of the effluent obtained was within thelimits of the national regulation [20] with a small exceptionfor the G installation (SBR cycle duration of 8 h) whereexceedances of the norms for nitrate were recorded ).However, given the high ammonia load of the influentwater, we can consider that the aerobic granular sludgeoperates in parameters while simultaneously removing theorganic matter, nitrifying / denitrifying and removing thephosphorus (figs.

10 1 and 2).The explanation behind incomplete denitrification inbioreactor G (after 8 h) could reside in the fact that a longerfamine period leads to fast organic load depletion duringthe first hours of the Treatment cycles leaving no COD fordenitrification heterotrophic process to occur. On the otherhand, long famine periods (in bioreactor G) favours thephosphorus uptake by phosphate accumulating microbial diversity in aerobic granular sludgesamples compared to a conventional activated sludgesample (used as inoculum) was assessed using Evolution in time, over an operating cycle, ofnitrogen (ammonium, nitrate, nitrite) in the twobioreactors: bioreactor D (6 h), bioreactor G (8 h). Evolution in time, over an operating cycle, ofphosphorus (phosphate) concentration in bothbioreactors: bioreactor D (6 h), bioreactor G (8 h) (Bucharest) 69 No.