Nice ESHGW12 JdD - Human Genome Variation Society

1 JT den DunnenMutation nomenclaturerecommendations for the description of DNA initiative JT den DunnenDefinitions prevent confusionmutation- change- disease-causing changepolymorphism- change in >1% population- not disease causing change betterneutral termssequence variantallelic variantalterationCNV(Copy Number Variant)SNV(not SNP) JT den DunnenPossible variants2 change in sequence change in amount change in positionACATCAGGAGAAGATGTTC GAGACTTTGCCAACATCAGGAGAAGATGTTT GAGACTTTGCCAACATCAGGAGAAGATGTT GAGACTTTGCCAACATCAGGAGAAGATGTTCCGAGACTTT GCCA JT den DunnenNomenclatureUnequivocalMemorableMe aningfulStable( describing DNA variants )

2 JT den DunnenMutation nomenclature2on behalf of HUGO MDI / HGVS JT den the recommendationswhen you disagree, start a debate do not use private rules, this only causes confusion JT den DunnenDNA, RNA, protein unique descriptionsprevent confusion DNAA, G, C, >T RNA( deduced mostly )a, g, c, >u protein( deduced only )three / one letter amino acid codeX = stop JT den DunnenReference Sequence use official HGNC gene symbols set the residues and : >T provide database referencecovering complete sequencelargest database(curated seqs) indicate type of Reference SequenceDNAcoding JT den Dunnencoding DNA or genomic ?

3 Human Genome sequencecompletecovers all transcriptsdifferent promoters, splice variants,different polyA-sites, .. ,895,321_21,895, is 70 Mb filenew builds follow each other regularly coding DNAdoes not cover all variantsgives a clue towards position JT den DunnenResidue numbering1 genomic reference sequencefrom first to last nucleotide1 to 13,562not +, - or other signs coding DNAfrom first of ATG to last of stop1 to 963-(minus) when 5' of ATGincl. 5' of cap site* (asterisk) when 3'of stop codonincl.

4 3' of polyA-addition siteintron362+1, 362+2, .. , 363-2, 363-1 end JT den DunnenReference SequenceF JT den DunnenResidue numbering2 RNA( deduced mostly )like coding DNA protein( deduced only )from first to last amino acid1 to 321 JT den DunnenTypes of Variation > , translocation, transposition complex combinationstwo allelesc.[123A>G]+[456C>T]>1 per allelec.[123A>G; 456C>T] JT den DunnenSubstitution substitution designated by ">"not used on protein level >T( : >T ) > JT den DunnenDeletion deletiondesignated by "del"range indicated by "_" or +?

5 Del= exon 3 to 6 deletion, breakpoint not sequenced JT den DunnenDuplication duplicationdesignated by "dup"range indicated by "_" or not describe as +?dup= exon 3 to 6 duplication, breakpoint not sequenced JT den DunnenInsertion insertiondesignated by "ins"range indicated by "_"give inserted sequence ,567when large insert submit to database andgive database number JT den DunnenInversion inversiondesignated by "inv"range indicated by "_" JT den DunnenConversion conversiondesignated by "con"range indicated by "_" JT den DunnenTranslocation translocationdesignated by "t"range indicated by "_" examplest(X;4) (.)

6 Q35) ( +101_857+102) JT den DunnenRepeated sequences mono-nucleotide (18_23) +28T(18_23)alleles 345+28T[18]+[21] di-nucleotide (3_6) (20_45) Kb repeat JT den DunnenSNP's SNP'sclear identifier for each : C>Grs2306220: A>GdbSNP entryDXS1219: (18_26)alleles [20]+[24] JT den DunnenSpecific codes codes used+, -, *>substitution_range;more changes in one allele,more transcripts / mosaicism( )uncertain[ ]alleledeldeletiondupduplicationinsinser tioninvinversionconconversionextextensio nXstop codonfsXframe shiftoopposite strandttranslocation JT den DunnenChanges in 2 alleles recessive diseasereport combination of changes alleleindicated by "[ ]"separated by "+" examplesc.

7 [546C>T]+[1398delT]or [ >T]+[ ]c.[546C>T]+[?]c.[546C>T]+[=] JT den DunnenAlleles recessive diseasec.[546C>T]+[2398delT]c.[546C>T]+[ ?] more changes in 1 allelec.[546C>T; 2398delT] alleles unknownc.[246C>T(+)2398delT]parents not analysed more variants from 1 allelemosaicism - c.[=, 546C>T]two transcripts - r.[=, 512_636del] JT den DunnenFrame shifts short form(sufficient) long from(more detail) amino acid changedpositionfirst changed amino acidlength shifted frame(from first changed to X incl.)

8 Do not describe del, dup, ins, not try to include changes at DNA level JT den DunnenComplex deletion / insertions"indel" descriptions nay become complexonly an expert understands the "code"consider database submissiondescription: JT den DunnenPublicationspatient# protein DNA Tyr151 Asp 451T>C parents .. frame shift 976delA parents unrelatedpatient# DNA RNA c.[451T>C(+) ?]

9 ? parents976delA] or NA (p.[Tyr151 Aspunrelated(+)Phe326fs])PublishedCorrec t JT den DunnenProblematic1 coding DNA Reference Sequenceno reference to genomic sequenceso, >G ?no reference to intron numberingso, >A ?new exon identified(CFTR, SMN1)exons12, 13, 13A, 14exons 2, -1, 1, 2, 3, ..difference with Genome browseralways from 1 to end JT den DunnenGene structure ? how are exons numbered ?often confusing how are introns numbered ?SMASMN1 exon 7exon 0 / intron 0where is exon 0 in a gene ?

10 , -2, -1, 0, 1, 2, .. , -2, -1, 1, 2, ..>> changes difficult to findnon-expert, student, .. JT den DunnenExon 0 Baker, Nature 442: 916 Cruts, Nature 442: JT den DunnenProblematic2 not described at DNA Abstract / Title / Resultsgives give >Cor >C ( )at least on first appearance range in +12_14del seems clear( probably +12_635+14del )but +121_128del ? JT den DunnenProblematic3 insertions503insT is not clearins at position 503 or after position 503 ?what about ? from name to one-letter AA-codeG ?