Example: bachelor of science

Supporting Information - PNAS

Supporting Information Liu et al. SI Materials and Methods Transfection of MicroRNA Mimics and Inhibitors. Peritoneal macro- Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 phages were transfected with 40 nM control microRNA mimics were from Sigma-Aldrich. PAM3 CSK4 and poly(I:C) were from (Ambion) or mouse miR-147 mimics (Ambion) using HIPerFect Invivogene. Rabbit anti-p65 and rabbit anti-STAT1 antibodies transfection reagents (Qiagen) according to the manufacturer's were from Santa Cruz. Protein G agarose beads were from instructions. At 2 days after transfection, the cells were washed Pierce. three times and then underwent treatments. Similarly, cells were transfected with 40 nM control locked nucleic acid (LNA). Mice. C57BL/6 mice were purchased from NCI-Frederick.

Cytokine ELISA. Immunoreactive mouse TNF- and mouse IL-6 was quantified using commercially available ELISA kits (R&D Systems), …

Tags:

  Pnas

Information

Domain:

Source:

Link to this page:

Please notify us if you found a problem with this document:

Other abuse

Advertisement

Transcription of Supporting Information - PNAS

1 Supporting Information Liu et al. SI Materials and Methods Transfection of MicroRNA Mimics and Inhibitors. Peritoneal macro- Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 phages were transfected with 40 nM control microRNA mimics were from Sigma-Aldrich. PAM3 CSK4 and poly(I:C) were from (Ambion) or mouse miR-147 mimics (Ambion) using HIPerFect Invivogene. Rabbit anti-p65 and rabbit anti-STAT1 antibodies transfection reagents (Qiagen) according to the manufacturer's were from Santa Cruz. Protein G agarose beads were from instructions. At 2 days after transfection, the cells were washed Pierce. three times and then underwent treatments. Similarly, cells were transfected with 40 nM control locked nucleic acid (LNA). Mice. C57BL/6 mice were purchased from NCI-Frederick.

2 Modified inhibitors (Exiqon) or mouse LNA miR-147 inhibitors TRIF / mice were purchased from Jackson Labs. MyD88 / (Exiqon). mice were previously described in (24). Age and sex matched mice were used. All animal protocols were approved by the UAB Transfection of Non-Targeting Control siRNA and NMES1-Coding Re- Institutional Animal Care and Use Committee (IACUC). gion Targeting siRNA. Peritoneal macrophages were transfected with 40 nM control non-targeting siRNA (Dhmarcon) or Cell Culture. The human embryonic kidney cell line HEK-293, NMES1 siRNA (Dhmarcon) using HIPerFect transfection re- mouse macrophage cell line RAW and human monocytic agents (Qiagen) according to the manufacturer's instructions. At cell line THP-1 were purchased from the American Type Culture 2 days after transfection, the cells were washed three times and Collection (ATCC).

3 Mouse peritoneal macrophages were elic- then underwent treatments. The sequence for NMES1 siRNA is: ited by injection of mL of 4% thioglycolate solution for sense 5 CGUGGUUAUUGAUCGGAAAUU 3 and antisense 4 days. Alveolar macrophages were obtained by bronchoalveolar 5 UUUCCGAUCAAUAACCACGUU 3 . lavage with PBS containing 5 mM EDTA. The cells were cultured in DMEM plus 10% FBS at 37 C and 5% CO2. Real-Time RT-PCR. To determine the expression of mouse GAPDH, TNF- , IL-1 , IFN- , IFN- , PYHIN, UBCH8, Intratracheal Instillation of LPS. C57BL/6 mice were intratracheally ZBP1, and primary mouse miR-147, cDNA was synthesized injected with 1 mg/kg LPS in 50 L PBS. At 0, 4, 24, 48, or 72 h using Taqman reverse transcription (RT) reagents (Applied after injection, the mice (n 5) were killed and the lungs Biosystems).

4 To determine the expression of mouse NMES1 and collected and homogenized in TRIzol solution to purify total primary human miR-147b, cDNA was synthesized using iScript RNA. Equal amounts of RNA from each mouse at each time cDNA Synthesis Kit (Bio-Rad). Real-time PCR was performed point were pooled for analysis. using a Lightcycler 480 SYBR Green I Master system (Roche). according to the manufacturer's instructions. The primers were Plasmids. To generate a construct that expresses mouse mature as followings: mouse GAPDH: 5 CGACTTCAACAGCAA- miR-147 under the control of tetracycline, the mouse full-length CTCCCACTCTTCC 3 and 5 TGGGTGGTCCAGGGTTT- NMES1 cDNA was amplified from mouse cDNA using the CTTACTCCTT 3 ; mouse TNF- : 5 CTGTAGCCCACGTCG- following primers: sense 5 GGT ACC CCTTTCTGAAAAGT- TAGC 3 and 5 TTGAGATCCATGCCGTTG 3 ; mouse IL- TCTGTGGAGCG 3 and antisense 5 CTC GAG GTTTATA- 1 : 5 TGTA ATGA A AGACGGCACACC 3 and 5.

5 CATTTCAAGGAAAATATCCAAGC 3 . The PCR product TCT TCT T TGGGTAT TGCT TGG 3 ; mouse IFN- : 5 . was cloned into pcDNA4 between KpnI and XhoI sites. The GGACTTTGGATTCCCGCAGGAGAAG 3 and 5 GCTG- resulting construct was termed pcDNA4-miR-147. To generate CATCAGACAGCCTTGCAGGTC 3 ; mouse IFN- : 5 AAC- a construct that can express mature murine miR-147 sequence, CTCACCTACAGGGCGGACTTCA 3 and 5 TCCCACGT- two complementary DNA oligos were synthesized and annealed. CA ATCT T TCCTCT TGCT T T 3 ; mouse PYHIN: 5 . The sequences for the oligos were sense 5 GATC CCC TAG- AGTTCCCAAAAGATGCTGGAGTGGA 3 and 5 TCCT- CAGAAGCATTTCCGCACAC TTCAAGAGA GTGTGCG- TCGGGAAGCAGTTGGTAAAGA 3 ; mouse UBCH8: 5 . GAAATGCTTCTGCTA TTTTTGGAAA 3 and antisense 5 CGCCAACTGTCTAGTGACTATGCCA 3 and 5 CCAGAT- AGCT TTTCCAAAAA TAGCAGAAGCATTTCCGCACAC TCGGTTTACTCACCAGCAC 3 ; mouse ZBP1: 5 AACCCT- TCTCTTGAA GTGTGCGGAAATGCTTCTGCTA GGG 3 , with CAATCAAGTCCTTTACCGC 3 and 5 TCTTCCACGTCT- the mature miR-147 sequence listed in bolded italics.

6 The GTCCGTCATAGCT 3 ; mouse primary miR-147/mouse annealed double-stranded oligo was then cloned into pBabe-H1 NMES1: 5 TCTACACTAAAGTCATCATGGGCGTTTT 3 . at HindIII and BglII sites. The resulting construct was termed and 5 AGAGGAGTGGTGAGCAATCATCTGG 3 ; human pBabe-H1-miR-147. The expression of mature miR-147 se- GAPDH: 5 GCGAGATCCCTCCAAAATCAA 3 and 5 GT- quence was initiated by the RNA polymerase III promoter, H1. TCACACCCATGACGAACAT 3 ; human primary miR-147b: 5 AACTCATTCCCTTGGTGGTGTTCAT 3 and 5 CTCGT- Generation of a Stable Cell Line Inducibly Expressing CATTTGGTCACCCTTTGGAC 3 . To determine the expres- miR-147. To generate a cell line that can inducibly sion of mouse mature miR-147 and human mature miR-147b, express miR-147, a tet-on system was used. First, cDNA was synthesized using Taqman reverse transcription cells were transfected with pcDNA6, which can express a tet reagents with specific human mature miR-147b RT primers repressor.

7 The transfected cells were selected with blasticidin for (Applied Biosystems), specific mouse small nucleolar RNA 135. 2 weeks. A single colony was isolated and checked for expression (snoRNA135) primers (Applied Biosystems), or specific human of the tet repressor. The positive clone was then transfected with small nuclear RNA U6 (RNU6) primers (Applied Biosystems). pcDNA4-miR-147. The cells were selected with zeocin for 2 Real-time PCR was performed using the Taqman Probe Master weeks, and a single colony was isolated and amplified. An (Roche) system with specific human mature miR-147b probes, individual cell clone was left uninduced or was induced to specific mouse snoRNA135 probes (Applied Biosystems), or express miR-147. Two positive clones ( #5 RNU6 probes (Applied Biosystems).)

8 SnoRNA135 and RNU6. and #8) were used for the study. served as an internal controls. Liu et al. 1 of 6. Cytokine ELISA. Immunoreactive mouse TNF- and mouse IL-6 Northern Blotting Assays. Total RNA (10 g) was resolved by 12%. was quantified using commercially available ELISA kits (R&D denatured polyacrylamide gel containing 8 M urea. After elec- Systems), according to the manufacturer's instructions. trophoresis, the gel was stainined with 1 g/mL ethidium bromide solution to view RNA loading. The RNA was then Luciferase Assays. The approximately 2 kb of the miR-147 pro- transferred to Hybond nylone membranes (GE Life Sciences). moter region upstream of the transcriptional starting site was After UV crosslinking, the membrane was incubated in prehy- obtained by PCR amplification. The primers were: 5 CTC- bridization buffer [50% formamide (USB), SDS, 5 SSC.]

9 GAGCCTGATACTGTAAACCTGGACAAGCA 3 and 5 (USB), 5 Denhardt's solution (USB), and 20 g/mL sheared, AAGCTTCTTTTCAGAAAGGAGACGCACCTAG 3 . The denatured, salmon sperm DNA (Invitrogen)] at 37 C for 30 min. PCR product was subcloned into a luciferase reporter plasmid The membrane was then hybridized with specific -p32 labeled pGL2 between the XhoI and HindIII sites and the resulting mouse LNA miR-147 probes (Exiqon) at 37 C for 24 h. The plasmid was termed FL. The promoter region with deletion of membrane was washed for 10 min three times with washing the two distal NF- B binding sites, deletion of the two distal buffer ( SDS, 2 SSC) and exposed to film. After hybrid- NF- B binding sites and the GAS element, or deletion of all ization with miR-147 probes, the membrane was striped and three NF- B binding sites and the GAS element was obtained by reblotted with specific -p32 labeled mouse U6 probes (Exiqon).

10 PCR amplification and subcloned into pGL2. The resulting as loading controls. constructs were termed 1, 2, and 3, respectively. The Chromatin Immunoprecipitation Assays. After experimental treat- forward primers for these fragments were: CTCGAGAA- ments, cells were fixed with 1% of formaldehyde for GATATAACTTCAGCCCTTCAATG ( 1), CTCGAGCA- 10 min. Cells were collected in cold PBS and resuspended in 1. GA A ACTGTGAGCCA A A AGTGATG ( 2), and CTC- mL TE buffer. Genomic DNA was then sheared to lengths GAGGGAGGAGGAGA AGA A ATCA ATCA ATC ( 3), ranging from 200 to 1,000 bp by sonication. One percent of cell respectively. The reverse primer was the same as that with FL. extract was taken out as input, and the rest of the extract was The promoter region with an internal deletion of the proximal incubated with rabbit anti-p65 polyclonal antibodies or rabbit NF- B binding sites and the GAS element was obtained by anti-STAT1 polyclonal antibodies overnight, followed by pre- replacing the fragment between PVUII and HindIII in the FL cipitation with protein G agarose beads.


Related search queries