Thermo Scientifi c Particle Technology Product Catalog and ...

1 Magnetic ParticlesNIST Traceable Size StandardsFlow CytometryDyed and Fluorescent ParticlesPlain Particles for Clinical Diagnostics and Specialty ApplicationsThermo Scientifi c Particle TechnologyProduct Catalog and Technical Reference GuideSeradyn and Duke Scientifi c have combined under the Thermo Scientifi c brand to offer customers one place for all the particles they need. We are pleased to announce the ability to leverage our individual strengths under this new brand name. Engineers, physicists, chemists, bio-chemists andother scientists use particles for molecular biology applications, as reference standards for sizemeasurement, for nucleic acid isolation and cell separation, as unique markers for biomolecules,as fl ow tracing devices, as reactive surfaces totransport diagnostic reagents and for a variety of other a trusted supplier to the scientifi c community with more than 35 years of Particle Technology experience.

2 We are proud of our reputation as theworld leader in the design and manufacture of highquality synthetic polymer experienced technical staff comes from manyscientifi c disciplines, which are integrated toprovide powerful solutions to problems and supportfor Scientifi c Product CategoriesMagnetic Particles Sera-Mag SpeedBeads Sera-Mag Magnetic ParticlesNIST Traceable Size Standards NIST Traceable Metrology Particles Duke Standards BCR Quartz Certifi ed Particles Certifi ed Count ParticlesFlow Cytometry Particles Cyto-Cal Calibrators, Alignment Beads and Count Control Cyto-Plex Carboxylate-modifi ed particles and Carboxylated Kits for Multiplex AssaysFluorescent and Dyed Particles Fluoro-Max Fluorescent Color-Rich Dyed ChromoSphere Dyed Particles for Clinical Diagnosticsand Specialized Applications Opti-Bind Opti-Link Turbi-BindTM Turbi-LinkTM Power-BindTM Streptavidin-coated Undyed Sulfate Particles with Modifi ed Surfaces Polymer Particle Suspensions Spherical Polymer Particles Spherical Glass Materials Spherical Pollen

3 And Spores Metal and Mineral Particles Filter and Smoke Detector Particles Cleanroom Particles Non-polymer particlesThermo Scientifi c particles are manufactured in ourISO regulated facilities, assuring a superior Product . Our particles feature high precision and excel-lent reproduceability, high binding capacity while keeping nonspecifi c binding low and maintaininglong-term we manufacture the particles, exten-sive information about their characteristics and functionallity is made available to you. We provideconcrete data, backed by years of clinical applica-tions research, which will take the mystery out of working with the can learn more by logging on to We are also availableby phone to answer technical questions, fulfi llproduct Catalog requests and to give pricing for size standards and fl ow cytometry Particle products,call magnetic and all other Particle products, call1-866-737-2396.

4 Thermo Scientifi c Particle Technology We have particles for all your diagnostic, calibration and molecular biology you approximately 85% of the US blood supply is tested by assays that utilize our of ContentsParticle Application Particles ..4 Magnetic Magnetic particles ..6 9 Technical Supplement: Particle Reagent Optimization ..10 13 NIST Traceable Size Calibration and Validation ..15-23 Count Controls ..24-27 Technical Supplement: Working with Particles .. 28 Flow Instrument Multiplex Assay Supplement: Differences in beads for fl ow cytometry.

5 35 Dyed and Fluorescent Particles ..36-37 Dyed Particles ..38-41 Fluorescent Supplement: Particle sonication and mixing .. 50-52 Particles for Clinical Diagnostics and Specialty Particles for Clinical Non-Polymer Particles ..60-66 Cleanroom Particles ..67 Technical Supplement: Selecting Particle surface properties .. 68 Striving to Meet Your Ordering Information ..69 Technical Payment Information ..692 ApplicationsMG SB CMMG SB SAMG SB NAMG-CMMG-SAMG-OLNIST Size ControlsCyto-CalCyto-PlexFluoro- SF GR, RD, BLFluoro-CM-EuFluorSA-EAir sampling smoke detectorsAffi nity purifi cationzzzzzAnalytical, Sedimentation.

6 SeperationzzBiotinylated PCR isolationzzzBiosensorszzzzzzcDNA synthesiszCell/DNA/mRNA isolationzzzzzCell labelingzzzCell sortingCell surface markersChemiluminescent assayszzzzzChemical engineering studiesClinical diagnosticsContamination control/ fl ow tracingCycle sequencing cleanupzzDispersion studiesFilter checking and testing/ challengeFiltration systemsFluid mechanicsFluorescent-based assayszzFlow cell focusingzzFlow cytometryzzGene expression analysis/ genotypingzzzzzzGenomicszzHigh sensitivity assayszzzzzzzzz zzInstrument precision monitoringzLaser Particle counter calibrationzz zzzLateral fl ow assayszzzLight scatteringzz zzMembrane-based assayszzzMolecular diagnosticszzzzzzMultiallurgical studiesNephelometric assaysNorthern analysiszzNucleic acid sample prepzzzzzzOptical alignmentzz zzParticle counting measurementzzzPhagocytosis studieszzPurify PCR productzzzzzPore size determinationzzProteomicszzzzzzRapid assayszzRT-PCRzzzzSize standardszz zzzSlide agglutination assayszzzSuspension array analysisTime-resolved fl uorescent assayszzTraceability of analytical methodszz zTurbidimetric

7 AssayszzzApplicationAAAAAAAAAAAAAAAApAAp pAApApApAppppppppppppppppppppplppppppplp pllppplplliipplipliliiilililiiicciiciici ccccccccaaccaccacaaaaaaaataataatatiaataa tiatiittitiioioioioooooonooononnzzzzzzzz zzzzro-EuModifi ed Fluoro-GR, RD, DRColor-Rich BlueColor-Rich Red Color Rich BlackChromo Sphere RD,BLKOpti-Bind SFOpti-Link CMTurbi-Bind SFTurbi-Link CMModified Undyed SFPower-Bind SAParticle Supsen-sionsPolymer MaterialsSmoke/ Hepa Checkzzzzzzzzzzzzzzzzzzzzzzzzzz zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz zzzzzzzzzzzzzzzzzz zzzzzzzzzzzzzzzzzzzzzzzzSF: Sulfate CM: Carboxylate-modifi edSA: Streptavidin coatedOL: Oligo(dT)NA: NeutrAvidin coatedRD: RedBL: BlueBLK: BlackGR: GreenEu: Europium ChelateMG: MagneticSB: SpeedBeadSize Std.

8 : Size StandardsFluoro: Fluoro-MaxAbbreviationKeyon ChartooooooonononononononnnnCCnnCnCCCCCC CCChhCChCChChhhCChCChChhhhhhhhaahhahhaha aaaaaaaraaraarartaarartrttrrtrttttttzzzz zzzzzzThermo Scientifi c Sera-Mag Magnetic ParticlesSera-Mag Magnetic SpeedBeads Sera-Mag Magnetic SpeedBeads Carboxylate-Modifi ed Sera-Mag Magnetic SpeedBeads NeutrAvidin Sera-Mag Magnetic SpeedBeads StreptavidinSera-Mag Magnetic Particles Sera-Mag Magnetic Carboxylate-Modifi ed Particles Sera-Mag Magnetic Oligo(dT) Particles Sera-Mag Magnetic Streptavidin Particles5 The Sera-Mag SpeedBeads are the newest entry in the Sera-Mag line of magnetic particles.

9 These particles respond twice as fast in a magnetic fi eld as our original Sera-Mag magnetic particles, and are available in carboxylate-modifi ed, NeutrAvidin and Streptavidin coated versions. They are especially useful in clinical immunoassays where speed of magnetic response is impor-tant, or for isolation from viscous solutions in molecular biology applications. All SpeedBeads have improved magnetic response time, but retain the original Sera-Mag properties including: Sensitivity Stability Physical integrity Colloidal stability Reproducibility High binding capacity Very slow settling rate in the absence of a magnetic fi eld Unaffected in conditions such as sonica-tion, drying.

10 Freezing and pH extremes Effective in a wide variety of clinical and molecular applications Cost effective Long shelf-lifeSpeedBeads Carboxylate-Modifi ed Double speed Sera-Mag base magnetic Particle Fast magnetic response time for clinicaldiagnostic assays Excellent for a variety of nucleic acidisolation applicationsSpeedBeads Streptavidin Use in demanding applications that require high binding capacity Much quicker isolation from viscous cell lysates Universal streptavidin-biotin isolationsystemsSpeedBeads NeutrAvidin Broad utility for a variety of high bindingcapacity needs Much quicker isolation from viscous cell lysates Potential lower non-specifi c bindingcharacteristicsTo order Thermo Scientifi c Sera-Mag Speed-Beads, call the Indianapolis, IN offi ce at1-866-737-2396 or at Scientifi c Sera-Mag SpeedBeadsOne of the newest additions to the Sera-Mag Product line are SpeedBeads.