Example: barber

Bacillus Megaterium Protein Expression System

11111B. Megaterium Kit 9/2004 Bacillus MegateriumProtein Expression SystemProduct Information and InstructionsSeptember 2004 Bacillus MegateriumProtein ExpressionSystemHandbook 200422222 B. Megaterium Kit 9 .. General features of Bacillus Megaterium .. Megaterium as Expression host .. of advantages .. examples .. pMM1522/pMM1525 for heterologous gene expressionin Bacillus Megaterium .. Cloning the DNA fragment of interest .. General remarks on handling Bacillus Megaterium .. Transformation of Bacillus Megaterium protoplasts .. Protein production .. Information .. 17 ContentBacillus megateriumBacillus megateriumBacillus megateriumBacillus megateriumBacillus Megaterium "- one of the most efficient Expression systemsone of the most efficient Expression systemsone of the most efficient Expression systemsone of the most efficient Expression systemsone of the most efficient Expression systemsdescribed in any organism so far! described in any organism so far!

1 B. megaterium Kit 9/2004 Bacillus Megaterium Protein Expression System Product Information and Instructions September 2004 Bacillus Megaterium Protein Expression

Tags:

  System, Expression, Protein, Bacillus, Megaterium, Bacillus megaterium protein expression system

Information

Domain:

Source:

Link to this page:

Please notify us if you found a problem with this document:

Other abuse

Advertisement

Transcription of Bacillus Megaterium Protein Expression System

1 11111B. Megaterium Kit 9/2004 Bacillus MegateriumProtein Expression SystemProduct Information and InstructionsSeptember 2004 Bacillus MegateriumProtein ExpressionSystemHandbook 200422222 B. Megaterium Kit 9 .. General features of Bacillus Megaterium .. Megaterium as Expression host .. of advantages .. examples .. pMM1522/pMM1525 for heterologous gene expressionin Bacillus Megaterium .. Cloning the DNA fragment of interest .. General remarks on handling Bacillus Megaterium .. Transformation of Bacillus Megaterium protoplasts .. Protein production .. Information .. 17 ContentBacillus megateriumBacillus megateriumBacillus megateriumBacillus megateriumBacillus Megaterium "- one of the most efficient Expression systemsone of the most efficient Expression systemsone of the most efficient Expression systemsone of the most efficient Expression systemsone of the most efficient Expression systemsdescribed in any organism so far! described in any organism so far!

2 Described in any organism so far! described in any organism so far! described in any organism so far! """""(Rygus and Hillen, 1991)33333B. Megaterium Kit 9/2004A new alternative to A new alternative to A new alternative to A new alternative to A new alternative to E. coli E. coli E. coli E. coli E. coli : stable Protein Expression with high: stable Protein Expression with high: stable Protein Expression with high: stable Protein Expression with high: stable Protein Expression with highyield - suited not only for industrial - suited not only for industrial - suited not only for industrial - suited not only for industrial - suited not only for industrial offers this improved Expression System as an easy-to-handle kit withE. coli/B. Megaterium shuttle vectors pMM1522, pMM1525 and - to be orderedseparately - B. Megaterium protoplasts ready for Introduction1. Introduction1. Introduction1. Introduction1. General features of General features of General features of General features of General features of Bacillus megateriumBacillus megateriumBacillus megateriumBacillus megateriumBacillus megateriumBeing first described over 100 years ago, B.

3 Megaterium has recently beengaining more and more importance in scientific as well as industrial source of the significant name " Megaterium " was the large size of thevegetative cells (over 1 m) and the spores. The capability of sporulation hasmade B. Megaterium an important tool for examining spore-mediated diseaseand cell Megaterium is able to grow on a wide variety of carbon sources and has, thus,been found in many ecological niches, such as waste from meat industry orpetrochemical effluents. Also documented has been the degradation of persist-ent insecticides by B. Megaterium (Sexana et al., 1987; Selvanayagam andVijaya, 1989) offering potential applications as detoxifying agent. One of thegenetic regulatory elements for carbon utilization is the xylose operon. It hasbeen described by Rygus and Hillen (1991) and is used in the Expression systemMoBiTec is offering in this B. Megaterium proteins are of importance. A family of P-450 cyto-chrome monooxygenases is similar to eukaryotic P-450 playing a role inmany diseases.

4 Industrial applications of enzymes excreted by B. megateriumare diverse, starting from amylases used in bread industry to penicillin amidase,which is used for generation of new synthetic comprehensive overview about the features of this unique organism is givenin Patricia S. Vary's review article "Prime time for Bacillus Megaterium " (1994). Bacillus megateriumBacillus megateriumBacillus megateriumBacillus megateriumBacillus Megaterium as Expression host as Expression host as Expression host as Expression host as Expression hostIn molecular biology, B. Megaterium has proven to be an excellent host for theexpression of non-homologous DNA. In the MoBiTec System with pMM1522 &pMM1525 (which are both derivaties of the original Rygus & Hillen pWH1520;Malten et al., 2004; Barg et al., 2005) as cloning vectors, the above mentionedxylose operon is used as regulatory element. The pMM1522 vector map isshown in Fig. 1, page B. Megaterium Kit 9/2004 The multiple cloning sites (MCS) that differ in pMM1522 and pMM1525 areshown in Fig.

5 2, page 6. The complete DNA sequences are available fordownload on our internet web page other bacilli strains B. Megaterium has the advantage, that none of thealkaline proteases are present. This fact enables an excellent cloning andexpression of foreign proteins without degradation (Meinhardt et al., 1989;Rygus and Hillen, 1991). In addition, there are no endotoxins found in thecell yields are exceptionally good, also if inexpensive substrates are plasmids are structurally and segregationally stable. The glucose dehydrogenase gene (ghd) has been cloned back intoB. Megaterium and remained stable without selective pressure over a period ofthree weeks with daily subculturing (Meinhardt et al., 1989).Several proteins have successfully been overproduced in B. Megaterium (seeapplication examples below). Rygus and Hillen (1991) describe cloning andexpression of the four Protein encoding genes lacZ from E.

6 Coli, gdh from , mro (mutarotase) from Acinetobacter and human puk (a uroki-nase-like plasminogen activator, rscuPA). Using the xylose operon the geneswere 130- to 350-fold induced without proteolysis. Such a System offers uniquepossibilities for the industrial production of proteins and is of great interest tomanufacturers in the biomedical field. In a diagnostic test for AIDS, the HIV coatprotein is commercially produced by B. Megaterium (Ginsburgh et al., 1989).2. Summary of advantages2. Summary of advantages2. Summary of advantages2. Summary of advantages2. Summary of advantages stable Protein Expression , high yield xylose operon: tightly regulated and efficiently inducible by xylose(up to 350-fold) excellent polylinker downstream of promoter allows versatile cloning additional BsrGI site enables cloning without modifying the N-terminus no indication of proteolytic instability even up to 5 h after induction,since alkaline proteases such as in B.

7 Subtilis are not produced endotoxins are not found in the cell wall suited for industrial large scale Protein production compatible with all Bacillus subtilis vectors pMM1525 provides signal peptide sequence for efficient Protein secretion55555B. Megaterium Kit 9/2004 Fig. 1 Map of pMM1522. Shuttle vector for E. coli/B. Megaterium . TetR (Bac), tetracycline resistanceBacillus; TetR', tetracycline resistance, incomplete and inactive; AmpR, ampicillin resistance ( ); xylR, xylose-dependent repressor; orf1, open reading frame under control of the xylose-inducible promoter PXylA; PXylA, xylA promoter; MCS, multiple cloning site; pBC16 ori, Bacillusorigin of replication; pBR322, (ColE1) origin of replication; repU, gene essential for plasmidreplication; orf1, open reading frame complete DNA sequence is available for download on our web page bpxylRTet (Bac)RAmpRorf1 PxylAMCS oripBC16oripBR322 Tet 'R Sac I Sma I Acc65I Eag I NgoMIV STOPorf1 Spe I Bgl II EcoICRI Xma I BamH I Kpn I Sph I Nae I BsrG I START BstB I BspE I repUSee page 6 for DNASee page 6 for DNASee page 6 for DNASee page 6 for DNASee page 6 for DNAsequence of multiplesequence of multiplesequence of multiplesequence of multiplesequence of multiplecloning B.

8 Megaterium Kit 9/2004 Fig. 2 Sequence of the multiple cloning sites (MCS) of pMM1522 (A) and pMM1525 (B). SPlipA, signal peptide sequence (extacellular esterase LipA).With pMM1522/pMM1525, gene fusions (translational fusions) as well as operon fusions (transcriptional fusions) are possible, depending on the cloningsite and reading frame chosen (details see chapter 4). START XylA SmaI, KpnI, BsrGI BstBI BspEI XmaI_ Acc65I SphI_ATGTACAATGGTCCAAACTAGTTCGAAGATCTCCG GAGCTCCCGGGATCCGGTACCGGCCGCATGCCGGCGGCAC CTCGCTA SpeI BglII EcoICRI, BamHI EagI NgoMIV, BanII,SacI NaeIACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT TCTTGCGGAGAACTGTGAATGCGCAAACCAA Stop START XylA SPlipA BsrGI_ATGTACAATGAAAAAAGTACTTATGGCATTCATT ATTTGTTTATCGCTGATTCTATCTGTTTTAGCCGCTCCGC CGTGTGGCGCANarI,SfoI SmaI, KpnI,KasI,BbeI BspEI XmaI_ Acc65I SphI_GGCGCCGCATTGAAGATCTCCGGAGCTCCCGGGAT CCGGTACCGGCCGCATGCCGGCGGCACCTCGCTAACGGAT TCACCACTCC BglII EcoICRI, BamHI EagI NgoMIV, BanII.

9 SacI NaeIAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGT GAATGCGCAAA Stop MCS MCS MCS MCS MCS MCS MCS MCS MCS MCS77777B. Megaterium Kit 9/20040204060801001203. Application Examples3. Application Examples3. Application Examples3. Application Examples3. Application ExamplesProteins successfully overproduced with the B. Megaterium System are: the catabolite control Protein ccpA -Ref. 2- xylose repressor (XylR) -Ref. 1- trehalose repressor (TreR) -Ref. 1- heat stable Protein (HPr) from PTS (phosphotransferase sugar transportsystem) mutarotase (Mro) -Ref. 1- glucose dehydrogenase (Gdh) -Ref. 1- -galactosidase human single-chain urokinase-like plasminogen activator (rscuPA) cellulase dextransucrase -Ref. 10- Protein yield: Protein yields vary depending on the Protein expressed. Rygus and Hillen(1991) have observed, that Gdh and Mro accumulated to 20 % and 30 %of the total soluble Protein , respectively.

10 The time dependence of the inducedexpression of these enzymes is shown in Fig. 3 Time dependence ofinduced Expression of theenzymes Gdh (glucosedehydrogenase) and Mro(mutarotase) in Bacillusmegaterium. Enzymaticactivity given in B. Megaterium Kit 9/20044. Using pMM1522/pMM1525 for heterolo-4. Using pMM1522/pMM1525 for heterolo-4. Using pMM1522/pMM1525 for heterolo-4. Using pMM1522/pMM1525 for heterolo-4. Using pMM1522/pMM1525 for heterolo-gous gene Expression in gous gene Expression in gous gene Expression in gous gene Expression in gous gene Expression in Bacillus megateriumBacillus megateriumBacillus megateriumBacillus megateriumBacillus megateriumPlasmids pMM1522/pMM1525 both contain the strong xylA promoter (PxylA)originating from Bacillus Megaterium . Transcription from this promoter is xyloseinducible (after xylose addition, the xylose repressor coded by the xylR gene onthe plasmids is released from PxylA and transcription is initiated).


Related search queries