Transcription of NGSの新たな利用法:16S rRNAメタゲノム解析の ポイント …
1 2012 Illumina, Inc. All rights , illuminaDx, BaseSpace, BeadArray, BeadXpress, cBot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic Energy, Genome Analyzer, GenomeStudio, GoldenGate, HiScan, HiSeq, Infinium, iSelect, MiSeq, Nextera, Sentrix, SeqMonitor, Solexa, TruSeq, VeraCode, the pumpkin orange color, and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective 16S rRNA May 9, 2014 2014 Illumina, Inc.
2 All rights , IlluminaDx, BaseSpace, BeadArray, BeadXpress, cBot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic Energy, Genome Analyzer, GenomeStudio, GoldenGate, HiScan, HiSeq, Infinium, iSelect, MiSeq, Nextera, NuPCR, SeqMonitor, Solexa, TruSeq, TruSight, VeraCode, the pumpkin orange color, and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners. Illumina s 16S rRNA webinar 16S rRNA Illumina 16S rRNA Protocol 16S : MiSeq Reporter 16S rRNA : (pdf): webinar(YouTube).
3 9 PCR amplifyTag gene (16S rRNA)ShotgunLibrary16S 16S Easy RapidInexpensiveDetect rare PhylotypesNo functional dataHigh output Long readsExpensiveHigh resolution functional data1016S rRNA 16S rRNA 16S rRNA 16S rRNA Fox GE et al. (1977) PNAS1116S rRNA 1,542 RNA 18S 16S rRNA 16S rRNA 12 Illumina 16S rRNA 13 V3 V4 MiSeq 16S rRNA 141) David AW Soergel, et al.
4 , Selection of primers for optimal taxonomic classification of environmental 16S rRNA gene sequences. The ISME Journal (2012), 1 52) Klindworth A, et al., Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res(2013), 41(1) 1)2)15 16S rRNA 16S V3-V4 460bp V4 254bp MiSeq V3 kit 2x301 Cycle Read V3 ) MiSeq Reporter BaseSpace (coming soon) Metagenomics Tailed-PCR Tm 16S Metagenomics Sequencing Library PreparationIllumina (pdf).
5 V3 V4 25 cycle PCR 460 bp Nextera XT index kit 8 cycle PCR 384 MiSeq 1 V3, V4 35,000-60,000 (MiSeq V3 kit )MiSeq Reporter Greengenes MiSeq MSR BaseSpace 2 1716S V3-V4 Forward Primer:5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGG GNGGCWGCAGR everse Primer:5 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTAC HVGGGTATCTAATCC Tailed-PCR (16S V V 16S V3-V4 18 16S Forward Primer:5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-{ }Reverse Primer:5 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-{ } 5 <~550bp PCR 19 Step 1.)
6 PCR5 DNA(5ng/uL, )FR16S V3-V4 Tailed PCR 50uL PCR ( AMPure Beads ) 5uL PCR 16S V3-V4 550bp 25 Cycle PCR 2x KAPA HiFi HotStart Ready Mix 2: Nextera XT Index Kit Nextera XT Index kit ( 384 )P5 Index 2 Index 1P716S V3-V4 AMPure Beads 25uL 16S V3-V4 630bp 2x KAPA HiFi HotStart Ready Mix 8 Cycle PCR 21 16S rRNA rRNA 23 *EPICENTRE ILLUMINAILLUMINAEPICENTREEPICENTRE DNA 16S SoilMaster DNA Extraction Kit*Meta-G-Nome DNA Isolation Kit or Water Kit*WaterMaster DNA Purification Kit*DNA
7 16S MiSeqBaseSpace, MSR, Nextera XTIndexing Kit16S V3-V4 Illumina 16S 24*EPICENTRE ILLUMINAILLUMINAEPICENTREEPICENTRE DNA 16S ExtractMasterFecal DNAE xtraction Kit*QuickExtractDNA Extraction Kit*BuccalAmpDNAE xtraction Kit*DNA 16S MiSeqBaseSpace, MSR, Nextera XTIndexing Kit16S V3-V4 Illumina 16S 2516S rRNA Low Diversity Low Diveristy Intensity Q score 26 Low Diveristy PhiX DNA MiSeq Control Software V3 kit 700-800K/mm2 PhiX5% (1000K/mm2 )
8 Quality PhiX 20% % Base27 AMPure Beads PCR Input DNA Quality/Quantitiy ng/ul nM NaOH pH 13 Index Index 2816S rRNA : 29 MiSeq Reporter 16S metagenomicsworkflow html MiSeq Reporter Read MiSeq Miseq Reporter 16S Metagenomics Report3016S rRNA : : FASTQ.
9 BaseSpace MiSeq MiSeqReporter Sunburst Classification Chart Top 20 Classification Results by Taxonomic Level31 MiSeq Reporter (MSR) 32 BaseSpace 16S Analysis Overview Outputs:PDF ReportsBaseSpaceSummary Pages with interactive visualizationsRaw data output files (CSV)Read classificationStatistics calculationMetagenomics report creationPrimary Analysis (create FASTQs)Raw sequencing data33 BaseSpace 16S Analysis ( !)BaseSpace app cloud MiSeq Reporter 3416S rRNA :1 Melissa Spears35 :GEORGE WEINSTOCK/ERICA SODERGRENThe Genome Institute at Washington University, St.
10 Louis, MO : 16S rRNA (V1-V3 and V3-V5) : MiSeq V3kit (2x301 cycle) Roche 454 454 16S rRNA 36 :MiSeq 454 ~88% Read1 Read2 : MiSeq 454 1/ 12 20 :454 ~20x 16S rRNA 37 Human Microbiome Project V3 V5 V1 V3 V3 V5 V1 V3 MiSeq V3 2x300bp V3 V5, 569bp, 2x300bp V1 V3, 507bp, : V4 ( ) V1 V2 ( ) V6 V9 (HMP )TGI : V1 V3 ( )38 92%94%V1-V3 (507bp)919
